Youblisher.com-683392-Manual de Participante Cedula A

  • Published on
    21-Oct-2015

  • View
    34

  • Download
    0

Embed Size (px)

Transcript

<ul><li><p>ASESORES INTERDISCIPLINARIOS </p><p>EN CAPACITACION</p><p>CCCC</p><p>CCCCGGGGCTCTCTCTTTTT1</p></li><li><p>ASESORES INTERDISCIPLINARIOS </p><p>EN CAPACITACION</p><p>INTRODUCCION</p><p>Se denomina Agentes de Seguros de Vida al que ha preparado para hacer dela venta de seguros una profesin. Si estuviramos en posibilidades de realizarun estudio, descubriramos que es fabulosa la cantidad de agentes de segurosque se adjudican este ttulo an careciendo de los conocimientos mselementales del seguro.</p><p>La personalidad profesional de un individuo se desarrolla en dos etapas: La primera consiste en la adquisicin de conocimientos La segunda en la aplicacin de esos conocimientos, transformados omodificados despus de su contacto con lo que es esencial en cada hombre.</p><p>CCCC</p><p>CCCCGGGGCTCTCTCTTTTT2</p><p>En virtud de los cambios que hoy enfrentamos en el sector asegurador enmateria de capacitacin, nuestro equipo se ha dado a la tarea de establecer unaestrategia cuyo objetivo fundamental es brindar o fortalecer sus conocimientostcnicos, jurdicos, operativos relacionados con las operaciones de vida, daosy accidentes personales, que le facilite acreditar su capacidad tcnica a travsde la sustentacin del examen ante la Comisin Nacional de Seguros y deFianzas, para la obtencin o refrendo de la cdula tipo A, ante la ComisinNacional de Seguros y de Fianzas.</p></li><li><p>ASESORES INTERDISCIPLINARIOS </p><p>EN CAPACITACION</p><p>CONTENIDOASPECTOS GENERALES</p><p>I.MARCO JURIDICO............................................................................................... 5 </p><p>I.1 LEY GENERAL DE INSTITUCIONES Y SOCIEDADES MUTUALISTAS ............................................... 8 DE SEGUROS</p><p>I.2 LEY SOBRE EL CONTRATO DE SEGUROS .......................................................................................... 28I.3 REGLAMENTO DE AGENTES DE SEGUROS Y DE FIANZAS................................................................ 41I.4 LEY DE PROTECCIN Y DEFENSA AL USUARIO DE</p><p>SERVICIOS FINANCIEROS...................................................................................................................... 45I.5 OPERACIN PARA LA PREVENCIN Y DETECCIN DE </p><p>OPERACIONES DE PROCEDENCIA ILICITA......................................................................................... 49I.6 SISTEMA FINANCIERO MEXICANO ..................................................................................................... . 53I.6.1 LAS INSTITUCIONES QUE OPERAN EN EL SISTEMA FINANCIERO, SU PRPSITO Y RELACION</p><p>ENTRE S ..................................................................................................................................................54I.6.2 TIPOS DE INTERMEDIARIOS FINANCIEROS Y LAS DIFERENCIAS ENTRE ELLOS..........................55I.6.3 RELACION ENTRE LAS AUTORIDADES, INSTITUCIONES E INTERMEDIARIOS DEL SISTEMA</p><p>FINANCIERO .......................................................................................................................................... 55</p><p>CONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICO</p><p>CCCC</p><p>CCCCGGGGCTCTCTCTTTTT3</p><p>FINANCIERO .......................................................................................................................................... 55I.6.4 SECTOR DE ORGANIZACIONES Y ACTIVIDADES AUXILIARES DE CRDITO.................................. 56I.6.5 SECTOR BURSATIL................................................................................................................................ 57I.6.6 SEGUROS Y FIANZAS........................................................................................................................... 58I.6.7 SISTEMAS DE AHORRO PARA EL RETIRO .........................................................................................581.6.8 SISTEMAS DE APOYO...........................................................................................................................59I.6.9 TERMINOLOGA BSICA....................................................................................................................... 60I.6.10 RELACION CON LOS SEGUROS QUE CONTEMPLAN INVERSIN................................................... 66</p><p>II.ASPECTOS TCNICOS....................................................................................... 80II.1 RIESGO.....................................................................................................................................................83II.2 COSTO DEL SEGURO.............................................................................................................................. 87II.3 SINIESTRO.................................................................................................................................................93</p><p>III ASPECTOS OPERATIVOS................................................................................. 74</p><p>III.1 DEL AGENTE............................................................................................................................................97III.2 DE LA ASEGURADORA...........................................................................................................................99III.3 ANTE LAS AUTORIDADES......................................................................................................................103</p></li><li><p>ASESORES INTERDISCIPLINARIOS </p><p>EN CAPACITACION</p><p>CONTENIDO</p><p>RIESGOS INDIVIDUALES DEL SEGURO DE PERSONAS</p><p>IV. VIDA INDIVIDUAL.............................................................................................107</p><p>IV.1 BASES TECNICAS....................................................................................................................................108IV.2 CONDICIONES GENERALES DE LA POLIZA..........................................................................................115IV.3 TIPOS DE PLANES....................................................................................................................................118IV.4 BENEFICIOS Y CLAUSULAS ADICIONALES........................................................................................... 121</p><p>V. ACCIDENTES Y ENFERMEDADES................................................................ 129</p><p>V.1 ACCIDENTES PERSONALES.................................................................................................................... 131V.2 GASTOS MEDICOS MAYORES................................................................................................................. 134V.3 SALUD......................................................................................................................................................... 141</p><p>RIESGOS INDIVIDUALES DEL SEGURO DE DAOS</p><p>CONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICOCONTENIDO TEMATICO</p><p>CCCC</p><p>CCCCGGGGCTCTCTCTTTTT4</p><p>V. AUTOMOVILES................................................................................................. 146</p><p>V.1 CONCEPTOS BASICOS........................................................................................................................... 147V.2 ESTRUCTURA DE LA POLIZA................................................................................................................. 150V.3 SINIESTROS............................................................................................................................................ 156</p><p>VI. POLIZA HOGAR ............................................................................................. 160</p><p>VI.1 CONCEPTOS BASICOS............................................................................................................................ 161VI.2 ESTRUCTURA DE LA POLIZA..................................................................................................................162VI.3 SINIESTROS..............................................................................................................................................175</p><p>VII. EMBARCACIONES MENORES DE PLACER ............................................. 177</p><p>VII.1 CONCEPTOS BASICOS.......................................................................................................................... 178VII.2 ESTRUCTURA DE LA POLIZA.................................................................................................................181VII.3 SINIESTROS.............................................................................................................................................183</p></li><li><p>ASESORES INTERDISCIPLINARIOS </p><p>EN CAPACITACION</p><p>CCCC</p><p>CCCCGGGGCTCTCTCTTTTT5</p></li><li><p>ASESORES INTERDISCIPLINARIOS </p><p>EN CAPACITACION</p><p>I.1 INTRODUCCIONAUTORIDADES Y DISPOSICIONES LEGALES</p><p>Desde sus inicios, hasta nuestros das, elhombre ha evolucionado y revolucionadosu entorno social; ha sido capaz demodificar su universo y dimensionar supropia existencia.El hombre se ha dado cuenta de que lanecesidad de seguridad es inherente,desde su origen, a l mismo y siente, porsus propias limitaciones, menester desalvaguardarse frente al medio en que sedesenvuelve.Esta necesidad de proteccin la haceextensiva a los suyos, su familia, sucomunidad y su pas. Se proteger ensu persona y en sus bienes contra lasconsecuencias econmicas daosas porlas posibles prdidas que le produzcanlos riesgos que le rodean y amenazan.As, a travs de diferentes caminos, vabuscando la suplencia de laincertidumbre, de lo desconocido. Este</p><p>NECESIDAD DE SEGURIDAD</p><p>DE SU PERSONA</p><p>DE SU FAMILIA</p><p>DE SUS COSAS</p><p>ACTIVIDAD ASEGURADORA</p><p>ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES</p><p>CCCC</p><p>CCCCGGGGCTCTCTCTTTTT6</p><p>incertidumbre, de lo desconocido. Estehecho ha dado como consecuencia lacreacin, formacin, perfeccin ydesarrollo de la Actividad Aseguradora.Cuando se habla de la actividadaseguradora, se est hablando entrminos de Institucin Jurdica, la cualse refiere a todas las figuras dotadas depersonalidad jurdica que lo componencomo:</p><p>El asegurador, El asegurado,intermediario del contrato de cobertura,Los Reaseguradores, Los Ajustadores deSiniestros y las autoridades que loregulan conforme a derecho.El seguro se ha convertido en Seguro deEmpresa, es decir, solamente lo otorganpersonas morales que son sociedades,con fines lucrativos o no, pero que estnconstituidas como empresas conforme ala Legislacin Mexicana.La amplitud requerida en el seguro,debido a la variedad de riesgos porcubrir, lleva a esta Institucin Jurdica arequerir de la aplicacin DE LEYESCOMPLEMENTARIAS YSUPLEMENTARIAS, y a la creacin deReglamentos de las propias leyesespecficas que implementen suaplicacin.</p><p>INSTITUCION JURIDICA</p><p>ASEGURADO INTERMEDIARIO</p><p>AUTORIDADES QUE REGULAN LA ACTIVIDAD</p><p>REASEGURADORES</p><p>AJUSTADORES</p><p>LA INSTITUCION JURIDICA REQUIERE DE :</p></li><li><p>ASESORES INTERDISCIPLINARIOS </p><p>EN CAPACITACION</p><p>LAS LEYES Y REGLAMENTOS queconforman el derecho en Seguros,aplicables en Mxico son:</p><p>1.- Ley General de Instituciones ySociedades Mutualistas de Seguros</p><p>2.- Ley Sobre el Contrato de Seguros3.-Reglamento de Agentes de Seguros y</p><p>de Fianzas4.-Reglamento de Seguro de Grupo</p><p>Como Leyes Complementarias y/oSuplementarias, ya que contienenconceptos especficos o relacionadosen materia de Seguros, se debentomar en cuenta las siguientes:</p><p>1.- Cdigo Civil2.-Cdigo Civil de Comercio3.-Ley de Proteccin y Defensa al</p><p>Usuario de Servicios Financieros4.-Ley de Navegacin5.-Ley de Vas Generales de</p><p>Comunicacin.</p><p>INSTITUCIONES QUE REGULAN LA ACTIVIDAD ASEGURADORA EN MEXICO</p><p>L.G.I.S.M.S.Ley General de Instituciones y </p><p>Sociedades Mutualistas de Seguros</p><p>Su objetivo principal es la proteccin de losintereses del pblico usuario de estosservicios, por lo que regulan a:</p><p> Las empresas que se organicen y funcionencomo Instituciones de Seguro y SociedadesMutualistas</p><p> Las Actividades y operaciones que lasmismas realicen</p><p> Las actividades y operaciones de los agentesde seguros</p><p> Las actividades y funciones de las dems</p><p>ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES</p><p>CCCC</p><p>CCCCGGGGCTCTCTCTTTTT7</p><p>Comunicacin.Existen otras Leyes que por sus</p><p>caractersticas y aplicabilidad, tienenque ver con el mbito de la ActividadAseguradora, mencionaremos algunas:</p><p> Ley de Navegacin y Comercio Martimo Ley del Banco de Mxico Ley General de Sociedades Mercantiles Ley de Instituciones de Crdito Ley General de ttulos y Operaciones de</p><p>Crdito Ley General de Organizaciones y</p><p>Actividades Auxiliares de Crdito Ley del Mercado de Valores Ley Monetaria de los Estados Unidos</p><p>Mexicanos Ley de Sociedades de Inversin Ley de Inversin Extranjera Ley de Agrupaciones Financieras. Ley Fiscal Federal Ley Federal del Trabajo Ley del Seguro Social Ley de los Sistemas de Ahorro para el</p><p>Retiro Ley General de Salud</p><p> Las actividades y funciones de las demspersonas relacionadas con la actividadaseguradora</p><p>Los lineamientos que debe seguir una empresa para constituirse como Aseguradora son:</p><p>LAS OPERACIONES Y RAMOS QUE VAN A TRABAJARLOS REQUERIMIENTOS MINIMOS FINANCIEROS COMO EL CAPITAL MINIMO DE GARANTIA. EL PORCENTAJE DE LA PRIMA PARA LA CONSTITUCIN DE LAS RESERVAS TECNICAS Y LA FORMA DE CONTABILIZAR SUS CUENTAS</p><p>LOS DIRECTIVOS QUE DEBEN EXISTIR PARA ADMINISTRARLALA FORMA EN QUE SE DEBEN ESTRUCTURAR SUS POLIZASNOTAS TECNICAS.</p></li><li><p>ASESORES INTERDISCIPLINARIOS </p><p>EN CAPACITACION</p><p>I.2 LEY GENERAL DE INSTITUCIONES Y SOCIEDADES MUTUALISTAS DE SEGUROSOPERACIONES Y RAMOSREQUISITOS Y RESTRICCIONES DE LEYPROHIBICIONES PARA LA COMERCIALIZACIONTIPOS DE CONTRATOSINFRACCIONES DEL AGENTEREQUISITOS PARA COBRO DE COMISIONES</p><p>Es una institucin constituida como sociedadannima, cuya funcin principal es la de asumirriesgos mediante el pago de una prima.</p><p>Es la entidad aseguradora formada por laasociacin de personas que se reparten entre slos riesgos que individualmente les corresponden.Puede ser a prima fija, prima variable oproporcional.</p><p>ARTICULO 7o. - Las autorizaciones paraorganizarse y funcionar como institucin osociedad mutualista de seguros, son por supropia naturaleza intransmisibles y sereferirn a una o ms de las siguientesoperaciones de seguro:I. - Vida;II.- Accidentes y enfermedades, en alguno oalgunos de los ramos siguientes:a).- Accidentes personales;b). - Gastos mdicos; yc). - Salud;III. - Daos, en alguno o algunos de los ramossiguientes:a). -Responsabilidad civil y riesgos profesionales;b). - Martimo y transportes;c). - Incendio;d). - Agrcola y de animales;</p><p>ASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALESASPECTOS GENERALES</p><p>CCCC</p><p>CCCCGGGGCTCTCTCTTTTT8</p><p>d). - Agrcola y de animales;e). - Automviles;f). - Crdito;g).- Diversos;h).- Terremoto y otros riesgos catastrficos; yi).- Los especiales que declare la Secretara deHacienda y Crdito Pblico, conforme a lodispuesto por el artculo 9o. de esta Ley.Las autorizaciones podrn otorgarse tambin parapracticar exclusivamente el reaseguro, en alguna oalgunas de las operaciones mencionadas en esteartculo o conforme a lo sealado en el artculo76A de esta ley.Tratandose de los seguros relacionados concontratos de seguros que tengan como baseplanes de pensiones o de superviviencia derivadosde las leyes de seguridad social a los que ser...</p></li></ul>